Journal: Science advances

Article Title: Oncogenic transcription factors instruct promoter-enhancer hubs in individual triple negative breast cancer cells.

doi: 10.1126/sciadv.adl4043

Figure Lengend Snippet: Fig. 3. Enhancer activity compacts SOX9 promoter-enhancer hub in individual TNBC cells. (A and B) SOX9 promoter participates in multiway interactions with its distal enhancer clusters in individual TNBC MB157 cells. Left: Allele percentages with SOX9 promoter interacting with SOX9.EC1, SOX9.EC3, or both (A) and SOX9.EC2, SOX9. EC3, or both (B) in MB157 (n = alleles). Right-top: SOX9 locus schematic, three-color DNA FISH 50-kb probes at SOX9 promoter (green), SOX9.EC3 (magenta), and SOX9.EC1 (A, red) or SOX9.EC2 (B, yellow). Locations per fig. S3A. Right-bottom: Representative cells. Blue: 4′,6-Diamidino-2-phenylindole (DAPI). (C and F) SOX9 enhancers inactiva- tion expands SOX9-EC1-EC3 and SOX9-EC2-EC3 hubs in individual TNBC MB157 cells. Cumulative distribution functions (CDFs) of SOX9-EC1-EC3 (C) and SOX9-EC2-EC3 (F) spatial perimeters in each MB157-dCas9-KRAB expressing control (CTRL), SOX9.EC1, SOX9.EC2, or SOX9.EC3 sgRNA [Kolmogorov-Smirnov (KS) test, n = cells]. Mean (±SD) perimeters (micrometers): (C) Left: CTRL/SOX9.EC1 sgRNA: 3.78 (±2.63)/4.36 (±2.63); middle: CTRL/SOX9.EC2 sgRNA: 3.78 (±2.63)/4.47 (±2.64); right: CTRL/SOX9.EC3 sgRNA: 3.39 (±2.56)/4.28 (±2.65). (G) Left: CTRL/SOX9.EC1 sgRNA: 3.83 (±2.71)/4.45 (±2.72); middle: CTRL/SOX9.EC2 sgRNA: 3.19 (±2.44)/4.26 (±2.61); right: CTRL/SOX9.EC3 sgRNA: 3.83 (±2.71)/4.22 (±2.56). (D and G) Allele percentages with SOX9 promoter interacting with SOX9.EC1, SOX9.EC3, or both (D) and SOX9.EC1, SOX9. EC3, or both (G) in MB157-dCas9-KRAB expressing CTRL, SOX9.EC1, SOX9.EC2, or SOX9.EC3 sgRNA (n = alleles). (E and H) Representative cells of 3C and 3D (E) or 3F and 3G (H). Blue: DAPI. (I) SOX9 promoter inactivation decreases SOX9-EC1-EC3 three-way interaction frequency across individual alleles in TNBC MB157. Top-left: Allele percent- ages with SOX9 promoter interacting with SOX9.EC1, SOX9.EC3, or both in MB157-dCas9-KRAB expressing CTRL or SOX9 promoter sgRNA (SOX9.P sgRNA) (n = alleles). Bottom-left: CDFs of SOX9-EC1-EC3 spatial perimeter in each MB157-dCas9-KRAB cell (KS test, n = cells). CTRL/SOX9.P sgRNA mean (±SD) perimeter: 3.90 (±2.62)/4.44 (±2.66) μm. Right: Representative cells. Blue: DAPI. Scale bars, 3 μm for nuclei and 0.5 μm for alleles.

Article Snippet: For the transcription factor CRISPR screen sgRNA pooled library, lentivirus was produced by transfecting HEK293T cells with helper plasmids (VSVG and psPAX2; Addgene: #12260) using FuGene HD (Promega, catalog no. E2311).

Techniques: Activity Assay, Expressing, Control

Journal: Science advances

Article Title: Oncogenic transcription factors instruct promoter-enhancer hubs in individual triple negative breast cancer cells.

doi: 10.1126/sciadv.adl4043

Figure Lengend Snippet: Fig. 6. SOX9 regulates oncogene MYC by positioning its enhancers. (A) Genome tracks showing enrichment of pairwise MYC enhancer-enhancer and promoter- enhancer interactions in a population of MB157 cells. From top to bottom: Colored circles marking location of Oligopaint DNA FISH probes labeling 50-kb regions at MYC promoter (green), MYC.EC1 (magenta), MYC.EC2 (red), MYC.EC3 (yellow), and T-ALL-restricted enhancer (black), H3K27ac and SOX9 levels as measured by ChIP-seq, and normalized interaction frequency as measured by SMC1 HiChIP at the MYC locus in MB157. MYC enhancer clusters are marked by grey boxes. (B) A total of 80% of differ- entially expressed genes with SOX9-bound promoter and distal enhancer participate in ensemble hyper-interacting hubs. MB157 hubs plotted in ascending order of their total connectivity as measured by SMC1 HiChIP in TNBC MB157. Hyper-interacting promoter-enhancer hubs are defined as the ones above the elbow of the ranked total connectivity plot. Hyper-interacting ensemble promoter-enhancer hubs containing genes that are significantly down-regulated in MB157-Cas9 cells transfected with SOX9 targeting sgRNA versus control sgRNA for 4 days and have SOX9-bound promoter and distal enhancer are marked in orange. (C to E) SOX9 loss significantly in- creases 3D distances between the MYC promoter and SOX9-bound MYC.EC2 (C) or MYC.EC3 (D) and SOX9-unbound MYC.EC1 (E) in individual cells. CDFs (left) and box and whiskers (middle) of the distances between the MYC promoter and SOX9-bound MYC.EC2 (C) and MYC.EC3 (D) and SOX9-unbound MYC.EC1 (E) in each MB157-Cas9 6 days after transduction with control sgRNA (CTRL) or SOX9-targeting sgRNA (SOX9 KO) (KS test, n = cells). Probe locations per 6A. CTRL/SOX9 KO mean (±SD) distance between MYC promoter and MYC.EC2: 0.389 (±0.358)/0.749 (±0.666) μm; MYC.EC3: 0.447 (±0.457)/0.591 (±0.551) μm; MYC.EC1: 0.494 (±0.447)/0.651 (±0.556) μm. Right: Represen- tative cells. Scale bar per 3A. Blue: DAPI.

Article Snippet: For the transcription factor CRISPR screen sgRNA pooled library, lentivirus was produced by transfecting HEK293T cells with helper plasmids (VSVG and psPAX2; Addgene: #12260) using FuGene HD (Promega, catalog no. E2311).

Techniques: Labeling, ChIP-sequencing, HiChIP, Transfection, Control, Transduction

Journal: Science advances

Article Title: Oncogenic transcription factors instruct promoter-enhancer hubs in individual triple negative breast cancer cells.

doi: 10.1126/sciadv.adl4043

Figure Lengend Snippet: Fig. 7. SOX9 loss decompacts MYC promoter-enhancer hubs. (A) MYC promoter participates in multiway interactions with its distal enhancer clusters in individual TNBC MB157 and MDA-MB-468 but not ER+ MCF7. Left: Percentage of alleles with MYC promoter interacting (<350 nm) with SOX9-unbound MYC.EC1, SOX9-bound MYC.EC3, or both MYC.EC1 and MYC.EC3 in MB157, MDA-MB-468, and MCF7 as measured by three-color Oligopaint DNA FISH with probes marked in Fig. 6A top genome track (n = alleles). Right: Representative MB157, MDA-MB-468, and MCF7 nuclei and two magnified alleles from three-color DNA FISH. Scale bar per 3A. Blue: DAPI. (B and C) SOX9 loss expands MYC-EC1-EC2 (B) and MYC-EC1-EC3 (C) promoter-enhancer hubs in individual MB157 and decreases three-way interaction frequency across individual alleles. Left: CDFs of MYC-EC1-EC2 (B) and MYC-EC1-EC3 (C) spatial perimeters in each MB157-Cas9 cell expressing CTRL or SOX9 KO sgRNA (KS test, n = cells). Probe locations per 6A. CTRL/SOX9 KO mean (±SD) perimeters MYC-EC1-EC2 (B): 3.84 (±2.70)/4.53 (±2.67) μm; MYC-EC1-EC3 (C): 3.10 (±2.58)/3.90 (±2.64) μm (n = cells). Middle: Allele per- centages with MYC promoter interacting (<350 nm) with MYC.EC1, MYC.EC2, or both MYC.EC1 and MYC.EC2 (B) and MYC.EC1, MYC.EC3, or both MYC.EC1 and MYC.EC3 (C) in CTRL and SOX9 KO MB157-Cas9. Right: Representative cells. Scale bar per 3A. Blue: DAPI.

Article Snippet: For the transcription factor CRISPR screen sgRNA pooled library, lentivirus was produced by transfecting HEK293T cells with helper plasmids (VSVG and psPAX2; Addgene: #12260) using FuGene HD (Promega, catalog no. E2311).

Techniques: Expressing

Journal: eLife

Article Title: The human origin recognition complex is essential for pre-RC assembly, mitosis, and maintenance of nuclear structure

doi: 10.7554/eLife.61797

Figure Lengend Snippet:

Article Snippet: In this study, all the sgRNAs targeting genes of interest as well as controls were cloned into LRG2.1 plasmid (derived from U6-sgRNA-GFP, Addgene: 108098) - as described ( ).

Techniques: Derivative Assay, Recombinant, Plasmid Preparation, Expressing, Cloning, CRISPR, Construct, Retroviral, Transfection, Transduction, Sequencing, Amplification, Flow Cytometry, Software, Genome Wide, Knock-Out, Staining

Journal: eLife

Article Title: Maximizing CRISPRi efficacy and accessibility with dual-sgRNA libraries and optimal effectors

doi: 10.7554/eLife.81856

Figure Lengend Snippet: ( A ) Comparison of growth phenotypes for all elements between our pilot single-sgRNA library and Horlbeck et al. data, merged by gene name (n=20,228 elements). Growth phenotypes are reported as γ (log 2 fold-enrichment of T final over T 0 , per doubling) and correlated between experiments (r=0.82). ( B ) Comparison of growth phenotypes for all elements between our pilot dual-sgRNA library and Horlbeck et al. data, merged by gene name (n=20,228 elements). Growth phenotypes are reported as γ and correlated between experiments (r=0.83). ( C ) Comparison of growth phenotypes for all elements between our pilot single- and dual-sgRNA libraries, merged by gene name (n=21,239 with 20,228 targeting elements and 1011 non-targeting elements). Growth phenotypes are reported as γ and correlated between experiments (r=0.86). ( D ) Comparison of true and false-positive rates in single element screens. ‘Positives’ (n=1363 elements) were defined as genes with a K562 CRISPRi growth screen p-value <0.001 and γ<–0.05 , and ‘negatives’ were defined as non-targeting control sgRNA pairs (n=1011 elements). ( E ) Comparison of recombination rates for non-targeting dual-sgRNA elements between replicates of our K562 growth screen. Non-targeting elements with a growth phenotype (γ>0.05 or γ<−0.05) were excluded (n=973 elements). Recombination rates were weakly correlated between replicates (r=0.30). ( f ) Comparison of recombination rates for all dual-sgRNA elements between replicates of our K562 growth screen (n=20,387 elements). Recombination rates were strongly correlated between replicates (r=0.77). ( G ) Comparison of recombination rates and growth phenotypes for all dual-sgRNA elements in our K562 growth screen (n=20,387 elements). Growth phenotypes are reported as γ. Recombination rates were strongly anticorrelated with growth phenotypes (r=−0.84).

Article Snippet: The human CRISPRi dual-sgRNA libraries with IBCs are available from Addgene (hCRISPRi_dual_1_2, Addgene #187246; hCRISPRi_dual_3_4, Addgene #187247; hCRISPRi_dual_5_6, Addgene #187248).

Techniques: Comparison, Control

Journal: eLife

Article Title: Maximizing CRISPRi efficacy and accessibility with dual-sgRNA libraries and optimal effectors

doi: 10.7554/eLife.81856

Figure Lengend Snippet: ( A ) Schematics of CRISPRi transcription repressor domains and general lentiviral expression construct used for all CRISPRi effectors. UCOE = ubiquitous chromatin opening element; SFFV = spleen focus-forming virus promoter; P2A = ribosomal skipping sequence; WPRE = woodchuck hepatitis virus post-transcriptional regulatory element. Further information on repressor domains and lentiviral expression constructs can be found in the main text and Materials and methods. ( B ) Experimental design to test effects of stable expression of each CRISPRi effector on growth and transcription in K562 cells. ( C ) Growth defects of effector-expressing cells, measured as the log 2 of the ratio of mCherry-negative (effector-expressing) to mCherry-positive (not effector-expressing) cells in each well normalized to the same ratio on day 0. mCherry levels were measured for 19 days after pooling cells. Data represent mean ± SD from three independent transductions of expression constructs. p-Values are from an unpaired two-tailed t-test comparing D19 values for each sample to the D19 value for the ‘no plasmid’ sample. Average percent growth defect per day is the log 2 D19 value divided by the number of days, multiplied by 100 for a percent value. ( D ) Clustered heatmap of correlation of transcript counts from K562 cells expressing indicated CRISPRi effectors or a GFP control. Correlations across samples were calculated using normalized counts (reads per million) for all genes with mean normalized count >1 and then clustered using the Ward variance minimization algorithm implemented in scipy. r 2 is squared Pearson correlation. Data represent three independent transductions of expression constructs. ( E ) Number of differentially expressed genes ( p <0.05) for cells expressing each effector versus cells expressing GFP only. p -Values were calculated using a Wald test and corrected for multiple hypothesis testing as implemented in DeSeq2. Figure 2—source data 1. p-Values and growth defects depicted in . Figure 2—source data 2. Data depicted in .

Article Snippet: The human CRISPRi dual-sgRNA libraries with IBCs are available from Addgene (hCRISPRi_dual_1_2, Addgene #187246; hCRISPRi_dual_3_4, Addgene #187247; hCRISPRi_dual_5_6, Addgene #187248).

Techniques: Expressing, Construct, Virus, Sequencing, Two Tailed Test, Plasmid Preparation, Control

Journal: eLife

Article Title: Maximizing CRISPRi efficacy and accessibility with dual-sgRNA libraries and optimal effectors

doi: 10.7554/eLife.81856

Figure Lengend Snippet: Design of constructs for CRISPR interference (CRISPRi) effector expression.

Article Snippet: The human CRISPRi dual-sgRNA libraries with IBCs are available from Addgene (hCRISPRi_dual_1_2, Addgene #187246; hCRISPRi_dual_3_4, Addgene #187247; hCRISPRi_dual_5_6, Addgene #187248).

Techniques: Construct, CRISPR, Expressing

Journal: eLife

Article Title: Maximizing CRISPRi efficacy and accessibility with dual-sgRNA libraries and optimal effectors

doi: 10.7554/eLife.81856

Figure Lengend Snippet: ( A ) Experimental design to measure knockdown mediated by different CRISPR interference (CRISPRi) effectors by delivering single guide RNAs (sgRNAs) targeting either essential genes or cell surface markers. ( B ) Depletion of K562 cells expressing essential gene-targeting sgRNAs and different CRISPRi effectors, measured as the ratio of mCherry-positive (sgRNA-expressing) to mCherry-negative (not sgRNA-expressing) cells in a given well. mCherry levels were measured for 12 days after transduction, starting on day 3. Data from two replicate transductions. ( C ) Percent knockdown of cell surface markers by different CRISPRi effectors in K562 cells. Cell surface marker levels were measured on day 6 post-transduction by staining with an APC-conjugated antibody. Knockdown was calculated as the ratio of median APC signal in sgRNA-expressing cells and median APC signal in cells expressing a non-targeting control sgRNA after subtraction of background APC signal. Data from two replicate transductions. Cells expressing dCas9 and a strong CD55-targeting sgRNA are represented by a single replicate. ( D ) Distribution of anti-CD151 signal intensity (APC) in individual cells from one representative transduction. Data from second replicate are shown in . Knockdown was quantified as in C as the ratio of the median APC signals. ( E ) Percentage of cells without observable knockdown despite expressing a strong sgRNA, as quantified from the fluorescence distributions.

Article Snippet: The human CRISPRi dual-sgRNA libraries with IBCs are available from Addgene (hCRISPRi_dual_1_2, Addgene #187246; hCRISPRi_dual_3_4, Addgene #187247; hCRISPRi_dual_5_6, Addgene #187248).

Techniques: Knockdown, CRISPR, Expressing, Transduction, Marker, Staining, Control, Fluorescence

Journal: eLife

Article Title: Maximizing CRISPRi efficacy and accessibility with dual-sgRNA libraries and optimal effectors

doi: 10.7554/eLife.81856

Figure Lengend Snippet: ( A ) Depletion of K562 cells expressing essential gene-targeting single guide RNAs (sgRNAs) and different CRISPRi effectors, measured as the ratio of mCherry-positive (sgRNA-expressing) to mCherry-negative (not sgRNA-expressing) cells in a given well, as in . mCherry levels were measured for 12 days after transduction, starting on day 3. Data from two replicate transductions. ( B ) Distribution of anti-CD151 signal intensity (APC) in K562 cells expressing indicated CRISPRi effectors from second replicate transduction. Knockdown was quantified as in . ( C ) Distribution of anti-CD81 signal intensity (APC) in K562 cells expressing indicated CRISPRi effectors from two replicate transductions. Knockdown was quantified as in . ( D ) Distribution of anti-CD55 signal intensity (APC) in K562 cells expressing indicated CRISPRi effectors from two replicate transductions. Cells expressing dCas9 and the CD55-targeting sgRNA are represented by a single replicate. Knockdown was quantified as in .

Article Snippet: The human CRISPRi dual-sgRNA libraries with IBCs are available from Addgene (hCRISPRi_dual_1_2, Addgene #187246; hCRISPRi_dual_3_4, Addgene #187247; hCRISPRi_dual_5_6, Addgene #187248).

Techniques: Expressing, Transduction, Knockdown

Journal: eLife

Article Title: Maximizing CRISPRi efficacy and accessibility with dual-sgRNA libraries and optimal effectors

doi: 10.7554/eLife.81856

Figure Lengend Snippet: ( A ) Distribution of anti-B2M signal intensity (APC) in individual RPE1 (left) and Jurkat (right) cells expressing indicated CRISPR interference (CRISPRi) effectors and single guide RNAs (sgRNAs). Knockdown was calculated as the ratio of median APC signal in transduced (sgRNA-expressing) cells and median APC signal in non-transduced cells in the same well, after subtraction of background APC signal. ( B ) Depletion of indicated cell surface markers in HepG2 (top), HuTu-80 (middle), and HT29 (bottom) cells expressing Zim3-dCas9. Cell surface marker levels were measured 6–14 days post-transduction by staining with APC-conjugated antibodies. Knockdown was calculated as the ratio of median APC signal in sgRNA-expressing cells and median APC signal in cells expressing a non-targeting control sgRNA after subtraction of background APC signal. ( C ) Distribution of anti-B2M signal intensity (APC) in individual K562 cells expressing indicated CRISPRi effectors and sgRNAs. The Zim3-dCas9 (Hygro) cell line was generated by transduction followed by hygromycin selection and does not express a fluorescent protein. Knockdown was calculated as in A .

Article Snippet: The human CRISPRi dual-sgRNA libraries with IBCs are available from Addgene (hCRISPRi_dual_1_2, Addgene #187246; hCRISPRi_dual_3_4, Addgene #187247; hCRISPRi_dual_5_6, Addgene #187248).

Techniques: Expressing, CRISPR, Knockdown, Marker, Transduction, Staining, Control, Generated, Selection

Journal: eLife

Article Title: Maximizing CRISPRi efficacy and accessibility with dual-sgRNA libraries and optimal effectors

doi: 10.7554/eLife.81856

Figure Lengend Snippet:

Article Snippet: The human CRISPRi dual-sgRNA libraries with IBCs are available from Addgene (hCRISPRi_dual_1_2, Addgene #187246; hCRISPRi_dual_3_4, Addgene #187247; hCRISPRi_dual_5_6, Addgene #187248).

Techniques: Stable Transfection, Marker, Flow Cytometry, Recombinant, Plasmid Preparation, Sequencing, Expressing, Purification, Amplification, Transfection, Software, Genome Wide

Journal: Aging (Albany NY)

Article Title: Fbxo7 and Pink1 play a reciprocal role in regulating their protein levels

doi: 10.18632/aging.202236

Figure Lengend Snippet: Expression of Fbxo7 and its PD familial mutants led to an accumulation of Pink1. The Pink1-Flag plasmid alongside Fbxo7-Myc or its mutated plasmids were co-transfected to three different cell lines ( A : HEK293A, B : HeLa and C : SH-Sy5y). 24 hours after transfection, the cells were treated by 10 μM CCCP for 2 hours. The total cell lysates were subjected to Western blot analyses by anti-Flag antibody for Pink1-Flag, anti-Myc antibody for Fbxo7-Myc, and anti-β-Actin for β-Actin. After the relative level of FL-Pink1 and PF-Pink1 was obtained by normalizing of two forms of Pink1 to β-Actin respectively, the relative ratio of the two forms of Pink1 was obtained by normalization of the relative level of the two forms of Pink1 to the control only transfected with Pink1. The relative ratios were shown as mean ± SD; n = 3 independent experiments; individual 2-way ANOVAs with Tukey’s multiple comparisons test; ***p<0.001.

Article Snippet: Pink1 sgRNA sequences: 5’-CACCGGTGATGTCCCTGCATGGAGCTGG-3’and 5’-AAACCCAGCTCCATGCAGGGACATCACC-3’; Pink1 Hom1 primers: 5’-TCCCCGACCTGCAGCCCAGCTCATCTCCTGAGAGCAGATCTG-3’ and 5’-CCGGAACCTCCTCCGCTCCCCAGGGCTGCCCTCCATGAGCA-3’; Pink1 Hom2 primers: 5’-AGTTCTTCTGATTCGAACATCGAACATGGCATCCTCTGTGTC-3’ and 5’-TGGAGAGGACTTTCCAAGCCTTTACTGCATGTTGACGCT-3’; siRNAs for human Fbxo7 were purchased from Santa Cruz Biotechnology (sc-75010).

Techniques: Expressing, Plasmid Preparation, Transfection, Western Blot, Control

Journal: Aging (Albany NY)

Article Title: Fbxo7 and Pink1 play a reciprocal role in regulating their protein levels

doi: 10.18632/aging.202236

Figure Lengend Snippet: Expression of Fbxo7 and its PD familial mutants resulted in an accumulation of endogenous Pink1 in a Pink1-Flag KI cell line. ( A ) a schematic illustration of an engineering strategy for generation of a Pink1-Flag KI cell line. Pink1 Hom1: Pink1 homology arm 1; NeoR: neomycin resistant gene; Pink1 Hom2: Pink1 homology arm 2. ( B ) confirmation of expression of Pink1-Flag in the positive Pink1-Flag KI clones with an anti-Flag antibody. The cells were treated by CCCP and MG-132. ( C ) expression of Fbxo7 and its PD familial forms led to accumulation of PF-Pink1. The plasmids harboring Fbxo7 or the PD associated mutations in Fbxo7 were transfected into the Pink1-Flag KI cells. The total cell lysates were analyzed by Western blots with anti-Flag and anti-Myc antibodies. After the relative level of Pink1 protein was obtained by normalizing of Pink to β-Actin, the relative ratio of Pink1 was obtained by normalization of the relative level of Pink1 from Fbxo7 transfected samples to the control only transfected with Pink1. The relative ratios were shown as mean ± SD; n = 3 independent experiments; individual 2-way ANOVAs with Tukey’s multiple comparisons test; ***p = 0.0007. ( D ) KD of Fbxo7 caused a decrease of PF-Pink1. The Fbxo7 siRNA and control siRNA were transfected into the Pink1-Flag KI cells. 14 hours after transfection, the cells were treated by 10 μM MG-132 for 2 hours. The total cell lysates were analyzed by Western blots with anti-Flag and anti-Fbxo7 antibodies. After the relative level of Pink1 protein was obtained by normalizing to β-Actin, the relative ratio of Pink1 was obtained by normalization of the relative level of Pink1 from siFbxo7 transfected samples to the control transfected with siCtrl. The relative ratios were shown as mean ± SD; n = 3 independent experiments; unpaired 2-tailed Student’s t test; **p = 0.0058.

Article Snippet: Pink1 sgRNA sequences: 5’-CACCGGTGATGTCCCTGCATGGAGCTGG-3’and 5’-AAACCCAGCTCCATGCAGGGACATCACC-3’; Pink1 Hom1 primers: 5’-TCCCCGACCTGCAGCCCAGCTCATCTCCTGAGAGCAGATCTG-3’ and 5’-CCGGAACCTCCTCCGCTCCCCAGGGCTGCCCTCCATGAGCA-3’; Pink1 Hom2 primers: 5’-AGTTCTTCTGATTCGAACATCGAACATGGCATCCTCTGTGTC-3’ and 5’-TGGAGAGGACTTTCCAAGCCTTTACTGCATGTTGACGCT-3’; siRNAs for human Fbxo7 were purchased from Santa Cruz Biotechnology (sc-75010).

Techniques: Expressing, Clone Assay, Transfection, Western Blot, Control

Journal: Aging (Albany NY)

Article Title: Fbxo7 and Pink1 play a reciprocal role in regulating their protein levels

doi: 10.18632/aging.202236

Figure Lengend Snippet: Expression of Fbxo7 and its PD familial mutants had no effect on Pink1 ubiquitination. The Pink1-Flag plasmid along with Fbxo7-Myc or its mutated plasmids were co-transfected into HEK 293A cells. 24 hours after transfection, the cells were treated by 10 μM MG132 for 2 hours. The total cell lysates were subjected to immune-precipitation (IP) with anti-Flag antibody after 5-minute boiling. The IPed samples and the total cell lysates were analyzed by western blot with anti-ubiquitin antibody for ubiquitinated Pink1, anti-Flag antibody for Pink1-Flag, anti-Myc antibody for Fbxo7 and Bag2. The total cell lysates were analyzed by Western blots with anti-Flag and anti-Myc antibodies. After the relative level of ubiquitinated Pink1 protein was obtained by normalizing of ubiquitinated Pink to total Pink1, the relative ratio of ubiquitinated Pink1 was obtained by normalization of the relative level of ubiquitinated Pink1 from Fbxo7 or Bag2 transfected samples to the control transfected with Pink1 only (top panel from IP). The relative ratios were shown as mean ± SD; n = 3 independent experiments; individual 2-way ANOVAs with Tukey’s multiple comparisons test; ***p<0.001.

Article Snippet: Pink1 sgRNA sequences: 5’-CACCGGTGATGTCCCTGCATGGAGCTGG-3’and 5’-AAACCCAGCTCCATGCAGGGACATCACC-3’; Pink1 Hom1 primers: 5’-TCCCCGACCTGCAGCCCAGCTCATCTCCTGAGAGCAGATCTG-3’ and 5’-CCGGAACCTCCTCCGCTCCCCAGGGCTGCCCTCCATGAGCA-3’; Pink1 Hom2 primers: 5’-AGTTCTTCTGATTCGAACATCGAACATGGCATCCTCTGTGTC-3’ and 5’-TGGAGAGGACTTTCCAAGCCTTTACTGCATGTTGACGCT-3’; siRNAs for human Fbxo7 were purchased from Santa Cruz Biotechnology (sc-75010).

Techniques: Expressing, Ubiquitin Proteomics, Plasmid Preparation, Transfection, Western Blot, Control

Journal: Aging (Albany NY)

Article Title: Fbxo7 and Pink1 play a reciprocal role in regulating their protein levels

doi: 10.18632/aging.202236

Figure Lengend Snippet: Pink1 stabilized Fbxo7 in SNc of mouse brain. The different parts of brain tissues were dissected from WT and Pink1 KO female mice with age of 13-16 weeks. The homogenates were analyzed by western blot to check the protein level of Fbxo7 ( A – C : The protein level of Fbxo7 was normalized to β-Actin, then the relative level of Fbxo7 from WT was further normalized to that from KO). The relative ratios were shown as mean ± SD; n = 4 independent experiments; unpaired 2-tailed Student’s t test; **p = 0.0028 for SNc; p = 0.5588 for Stratium; p = 0.9763 for Cortex. ( D ) the mRNAs of Fbxo7 from SNc of WT and KO were analyzed by RT-qPCR. The relative ratios were shown as mean ± SD; n ≥ 5 independent experiments; unpaired 2-tailed Student’s t test; p = 0.392. ( E ) expression of Pink1 had no effect on Fbxo7 in HEK 293A cells. The relative ratios were shown as mean ± SD; n = 3 independent experiments; unpaired 2-tailed Student’s t test; p = 0.8255.

Article Snippet: Pink1 sgRNA sequences: 5’-CACCGGTGATGTCCCTGCATGGAGCTGG-3’and 5’-AAACCCAGCTCCATGCAGGGACATCACC-3’; Pink1 Hom1 primers: 5’-TCCCCGACCTGCAGCCCAGCTCATCTCCTGAGAGCAGATCTG-3’ and 5’-CCGGAACCTCCTCCGCTCCCCAGGGCTGCCCTCCATGAGCA-3’; Pink1 Hom2 primers: 5’-AGTTCTTCTGATTCGAACATCGAACATGGCATCCTCTGTGTC-3’ and 5’-TGGAGAGGACTTTCCAAGCCTTTACTGCATGTTGACGCT-3’; siRNAs for human Fbxo7 were purchased from Santa Cruz Biotechnology (sc-75010).

Techniques: Western Blot, Quantitative RT-PCR, Expressing

Journal: Cell Genomics

Article Title: Recurrent breakpoints in the BRD4 locus reduce toxicity associated with gene amplification

doi: 10.1016/j.xgen.2025.100815

Figure Lengend Snippet: Use of CRISPR-Cas9 technology to mimic the effect of BRD4 focal deletions (A) Confirmation of Cas9 expression in OVSAHO cells by immunoblotting. (B) Fraction of GFP + cells detected in Cas9 activity assay. To measure Cas9 cutting efficiency, OVSAHO-Cas9 cells were transduced with a vector encoding GFP and sgGFP. After 10 days, a decreased population of GFP + cells was detected by flow cytometry, confirming Cas9 activity. (C) Intronic BRD4 regions targeted by CRISPR-Cas9 sgRNAs (inset not to scale due to length of intron 1). (D) CRISPR sequencing results for sgBRD4_region1 and sgBRD4_region2, showing the percentage of uncut, frameshift, and in-frame BRD4 reads when aligned to a reference sequence. (E) Expression of BRD4 isoforms following CRISPR-Cas9-mediated sgRNA cutting, relative to sgGFP control. Median and standard deviations of three replicates, two-way ANOVA. (F) Quantification of cell confluency in OVSAHO-Cas9 cells following CRISPR-Cas9-mediated sgRNA cutting of BRD4 regulatory regions or sgGFP control. Mean and standard deviation of three replicates, two-way ANOVA followed by Dunnett post-tests, controlling the Family-wise alpha threshold and confidence level. p values of the final time point are annotated. (G) Landscape of BRD4 dependency across ovarian cancers. Chronos scores (with mean and standard deviation) are shown for every ovarian cancer cell line included in the DepMap Public 23Q4 release. A score of −1 (median score for essential genes; red dashed line) is used as reference to indicate genetic dependency.

Article Snippet: The lentiviral vectors pXPR_BRD111 and pXPR_BRD016 expressing human SpCas9 and a single-guide RNA (sgRNA) of interest, respectively, were acquired from the GPP Platform (Broad Institute of MIT and Harvard).

Techniques: CRISPR, Expressing, Western Blot, Activity Assay, Transduction, Plasmid Preparation, Flow Cytometry, Sequencing, Control, Standard Deviation

Journal: Cell Genomics

Article Title: Recurrent breakpoints in the BRD4 locus reduce toxicity associated with gene amplification

doi: 10.1016/j.xgen.2025.100815

Figure Lengend Snippet:

Article Snippet: The lentiviral vectors pXPR_BRD111 and pXPR_BRD016 expressing human SpCas9 and a single-guide RNA (sgRNA) of interest, respectively, were acquired from the GPP Platform (Broad Institute of MIT and Harvard).

Techniques: Virus, Expressing, Recombinant, Plasmid Preparation, Transfection, cDNA Synthesis, Bicinchoninic Acid Protein Assay, Software, CRISPR, Amplification, Sequencing

Journal: The EMBO Journal

Article Title: FBXL4 ubiquitin ligase deficiency promotes mitophagy by elevating NIX levels

doi: 10.15252/embj.2022112799

Figure Lengend Snippet: Quantitative RT–PCR reactions of FBXL4 (normalized to actin) were performed with cDNA derived from hTERT‐RPE1 cells transfected with non‐targeting (NT1) or siRNA‐targeting FBXL4. Two primer pairs were used and are indicated by symbol shape. Shown is the fold change normalized to NT1 control samples for three independent colour‐coded experiments. Error bars show standard deviation; unpaired t ‐test, **** P < 0.0001. Quantitative RT–PCR reactions of BNIP3 or NIX (normalized to actin) were performed with cDNA derived from hTERT‐RPE1 cells transfected with non‐targeting (NT1) or siRNA‐targeting FBXL4 or HIF1α (HIF). Two primer pairs were used per target indicated by different symbol shapes. Shown is the fold change normalized to the NT1 control samples for three independent colour‐coded experiments. Error bars show standard deviation; one‐way ANOVA and Dunnett's multiple‐comparison test, ** P < 0.01, *** P < 0.001 and **** P < 0.0001. Sequencing analysis of FBXL4‐knockout RPE1‐Cas9i‐mt‐mkeima cell pools KO1 and KO2 using Synthego ICE analysis. Shown are the predicted edit and KO efficiency for each pool. Western blot of lysates from matched control (Ctrl) and FBXL4 knockout RPE1‐Cas9i‐mt‐mkeima cell pools probed for the mitochondrial protein TOMM40. Quantification of data shown in D for four colour‐coded independent experiments. Error bars show standard deviation. One‐way ANOVA with Tukey's multiple‐comparison test, * P < 0.05. Western blot of lysates as in (D) probed for cathepsin D. Bands corresponding to mature and pro‐cathepsin D (Pro) are indicated. A ponceau stain is shown to illustrate equal loading across the length of the lane. *Indicates a non‐specific band. Source data are available online for this figure.

Article Snippet: The PAC sgRNA (5′‐TGTCGAGCCCGACGCGCGTG‐3′) was cloned into the pSpCas9(BB)‐2A‐GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA‐1 (5′‐TTGGTCAGAGAGACCTACGA‐3′) and FBXL4 sgRNA‐2 (5′‐TGGACTACCTCTGCATTGAG‐3′) plasmids were cloned into the pLenti‐sgRNA (71409; Addgene) vector.

Techniques: Quantitative RT-PCR, Derivative Assay, Transfection, Control, Standard Deviation, Comparison, Sequencing, Knock-Out, Western Blot, Staining

Journal: The EMBO Journal

Article Title: FBXL4 ubiquitin ligase deficiency promotes mitophagy by elevating NIX levels

doi: 10.15252/embj.2022112799

Figure Lengend Snippet: Representative western blot of two matched pairs of control (Ctrl) and FBXL4 KO pool RPE1‐Cas9i‐mt‐mKeima cells, generated with two distinct sgRNAs. Quantification of data represented in A. Individual data points from n = 3 independent colour‐coded experiments are shown. Error bars show standard deviation of the fold change in BNIP3 and NIX in each KO pool normalized to their matched control pools; one‐way ANOVA and Tukey's multiple‐comparison test, ** P < 0.01 and **** P < 0.0001. Representative images of Ctrl and FBXL4 KO pool RPE1‐Cas9i‐mt‐mKeima cells fixed and stained for either BNIP3 or NIX and co‐stained for TOMM20. Scale bar 20 μm. Representative images of control or FBXL4 KO pool RPE1‐Cas9i‐mt‐mKeima cells. “Magenta only” puncta (Ex. 561) correspond to acidic mitolysosomes. Scale bar 20 μm. Graphs show the quantification of mitolysosomes (mt‐mKeima “magenta only” puncta) per cell. A minimum of 45 cells were analysed per condition in each experiment. Individual data from two (for control 1 (Ctrl 1) and knockout 1 (KO1)) or three (control 2 (Ctrl 2) and knockout 2 (KO2)) are shown using different colours for each independent experiment. Mean and standard deviation are indicated. Bottom graph shows the individual data points. One‐way ANOVA with Tukey's multiple‐comparison test, * P < 0.05. Basal mitophagy was analysed in Ctrl and FBXL4 KO RPE1‐Cas9i‐mt‐mKeima cells by flow cytometry. High mitophagy gates were set using the corresponding control for each knockout. Three independent colour‐coded experiments are shown; one‐way ANOVA and Tukey's multiple‐comparison test, ** P < 0.01. Quantitative RT–PCR reactions of BNIP3 and NIX (normalized to actin) were performed with cDNA derived from control and FBXL4 KO RPE1‐Cas9i‐mt‐mKeima cells. Two primer pairs were used per target and are indicated by symbol shape. Three independent colour‐coded experiments are shown. Error bars show standard deviation of the fold change of BNIP3 and NIX mRNA in each KO pool normalized to their matched control pools. Representative western blot of control and FBXL4 KO RPE1‐Cas9i‐mt‐mKeima cells probed for HIF1α. Source data are available online for this figure.

Article Snippet: The PAC sgRNA (5′‐TGTCGAGCCCGACGCGCGTG‐3′) was cloned into the pSpCas9(BB)‐2A‐GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA‐1 (5′‐TTGGTCAGAGAGACCTACGA‐3′) and FBXL4 sgRNA‐2 (5′‐TGGACTACCTCTGCATTGAG‐3′) plasmids were cloned into the pLenti‐sgRNA (71409; Addgene) vector.

Techniques: Western Blot, Control, Generated, Standard Deviation, Comparison, Staining, Knock-Out, Flow Cytometry, Quantitative RT-PCR, Derivative Assay

Journal: The EMBO Journal

Article Title: FBXL4 ubiquitin ligase deficiency promotes mitophagy by elevating NIX levels

doi: 10.15252/embj.2022112799

Figure Lengend Snippet: A, B hTERT‐RPE1 cells were co‐transfected with Flag (V) or FBXL4‐Flag (FL4) and GFP (Vect), GFP‐BNIP3 or GFP‐NIX. Lysates were subjected to immunoprecipitation (IP) with either GFP‐nanobody‐coupled beads (A) or Flag‐antibody‐coupled agarose beads (B). IPs were probed alongside the input samples for Flag and GFP. C hTERT‐RPE1 cells were co‐transfected with FBXL4‐Flag (WT) or FBXL4‐R482W‐Flag (RW) and GFP, GFP‐BNIP3 (BNIP3) or GFP‐NIX (NIX). Lysates were subjected to immunoprecipitation with GFP‐nanobody‐coupled beads, and IPs were probed alongside the input samples for Flag and GFP. D hTERT‐RPE1 cells were transfected with empty vector (V), FBXL4‐Flag (WT) or FBXL4‐R482W‐Flag (RW). Lysates were subjected to IP with Flag‐antibody‐coupled agarose beads and probed for SKP1 and Flag. Note that FBXL4‐Flag presents with an as‐yet‐uncharacterized higher‐molecular‐weight band (indicated by a blue arrowhead) that is not enriched in the GFP‐BNIP3 or ‐NIX pulldowns (A–D). E Quantitation of SKP1 protein co‐immunoprecipitated with FBXL4‐R482W‐Flag relative to FBXL4‐Flag (WT). Data from two independent experiments are shown, normalized to the amount of SKP1 in the input and FBXL4‐Flag in the IP. F, G Representative images of control (Ctrl) and FBXL4 KO RPE1‐Cas9i‐mt‐mKeima cells transfected with FBXL4‐Flag wild‐type (WT) or FBXL4‐Flag [R482W] for 24 h, then fixed and stained for either BNIP3 or NIX. Scale bar 20 μm. Quantitation of the frequency of high BNIP3 and high NIX phenotypes observed in (F) and (G). A minimum of 32 Flag‐positive (transfected, indicated by an asterisk in the images) and Flag‐negative cells were analysed per condition in each experiment. Shown are the mean and individual data points of two colour‐coded experiments. H Western blot of control and FBXL4 KO RPE1‐Cas9i‐mt‐mKeima cells transfected as in (F) and (G) with Flag (V), FBXL4‐Flag (WT) or FBXL4‐Flag [R482W] (RW) for 24 h. Source data are available online for this figure.

Article Snippet: The PAC sgRNA (5′‐TGTCGAGCCCGACGCGCGTG‐3′) was cloned into the pSpCas9(BB)‐2A‐GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA‐1 (5′‐TTGGTCAGAGAGACCTACGA‐3′) and FBXL4 sgRNA‐2 (5′‐TGGACTACCTCTGCATTGAG‐3′) plasmids were cloned into the pLenti‐sgRNA (71409; Addgene) vector.

Techniques: Transfection, Immunoprecipitation, Plasmid Preparation, Molecular Weight, Quantitation Assay, Control, Staining, Western Blot

Journal: The EMBO Journal

Article Title: FBXL4 ubiquitin ligase deficiency promotes mitophagy by elevating NIX levels

doi: 10.15252/embj.2022112799

Figure Lengend Snippet: A, B Control (Ctrl) or FBXL4 KO RPE1‐Cas9i‐mt‐mkeima cells were treated for 72 h with non‐targeting (NT1), BNIP3 (B3), NIX or HIF1α (HIF) siRNA. (A) Representative images of the mt‐mKeima reporter in control (Ctrl2) or FBXL4 KO2 RPE1‐Cas9i‐mt‐mkeima. “Magenta only” puncta (Ex. 561) correspond to acidic mitolysosomes. Scale bar: 20 μm. (B) Flow cytometry analysis providing a quantitative assessment of basal mitophagy. High mitophagy gates were set for each matched pair of control and KO cells using the non‐targeting (NT) siRNA‐treated control pool sample as a reference. Data shown represent three colour‐coded independent experiments. Error bars show standard deviation. One‐way ANOVA and Dunnett's multiple‐comparison test, ** P < 0.01, *** P < 0.001 and **** P < 0.0001. C Representative western blot verifying the knockdown efficiency for samples shown in (B). Source data are available online for this figure.

Article Snippet: The PAC sgRNA (5′‐TGTCGAGCCCGACGCGCGTG‐3′) was cloned into the pSpCas9(BB)‐2A‐GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA‐1 (5′‐TTGGTCAGAGAGACCTACGA‐3′) and FBXL4 sgRNA‐2 (5′‐TGGACTACCTCTGCATTGAG‐3′) plasmids were cloned into the pLenti‐sgRNA (71409; Addgene) vector.

Techniques: Control, Flow Cytometry, Standard Deviation, Comparison, Western Blot, Knockdown

Journal: The EMBO Journal

Article Title: FBXL4 ubiquitin ligase deficiency promotes mitophagy by elevating NIX levels

doi: 10.15252/embj.2022112799

Figure Lengend Snippet: A Representative western blot of hTERT‐RPE1 cells treated with DMSO, antimycin (1 μM) and oligomycin (10 μM) (AO) or MLN4924 (1 μM) for 24 h. B Representative images of hTERT‐RPE1 cells treated with DMSO or MLN4924 (1 μM) for 24 h, fixed and stained for either BNIP3 or NIX and for TOMM20. Scale bar 20 μm. C Quantitative RT–PCR reactions of BNIP3 or NIX (normalized to Actin) were performed with cDNA derived from hTERT‐RPE1 cells treated with DMSO or MLN4924 (1 μM) for 24 h. Two primer pairs were used per target indicated by different symbol shapes. Shown is the fold change normalized to the DMSO control sample for three independent colour‐coded experiments. Error bars show standard deviation; unpaired t ‐test, *** P < 0.001 and **** P < 0.0001. D Representative western blot of hTERT‐RPE1 cells pre‐treated with DMSO or MLN4924 (1 μM) for 6 h, followed by a cycloheximide chase (100 μg/ml). E Representative western blot of lysates from control (Ctrl1) or FBXL4 KO1 RPE1‐Cas9i‐mt‐mKeima cells pre‐treated without or with MLN4924 (1 μM) for 6 h followed by a cycloheximide (CHX) chase (100 μg/ml). F, G Quantification of protein levels calculated from data represented in (E) for three independent colour‐coded experiments. Error bars show standard deviation. H Representative western blot of hTERT‐RPE1 cells transfected for 72 h with siRNA against indicated targets or non‐targeting (NT1) prior to harvesting and cell lysis. Source data are available online for this figure.

Article Snippet: The PAC sgRNA (5′‐TGTCGAGCCCGACGCGCGTG‐3′) was cloned into the pSpCas9(BB)‐2A‐GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA‐1 (5′‐TTGGTCAGAGAGACCTACGA‐3′) and FBXL4 sgRNA‐2 (5′‐TGGACTACCTCTGCATTGAG‐3′) plasmids were cloned into the pLenti‐sgRNA (71409; Addgene) vector.

Techniques: Western Blot, Staining, Quantitative RT-PCR, Derivative Assay, Control, Standard Deviation, Transfection, Lysis

Journal: The EMBO Journal

Article Title: FBXL4 ubiquitin ligase deficiency promotes mitophagy by elevating NIX levels

doi: 10.15252/embj.2022112799

Figure Lengend Snippet: A Representative western blot of lysates from control or FBXL4 KO RPE1‐Cas9i‐mt‐mKeima cells treated with MLN4924 (1 μM) for 6 h. B Representative western blot of lysates from control or FBXL4 KO RPE1‐Cas9i‐mt‐mKeima cells pre‐treated without or with MLN4924 (1 μM) for 6 h followed by a cycloheximide (CHX) chase (100 μg/ml). C, D Quantification of protein levels calculated from data represented in (B) for three colour‐coded independent experiments. Error bars show standard deviation. E Western blot of lysates from control (Ctrl2) or FBXL4 KO2 RPE1‐Cas9i‐mt‐mKeima cells pre‐treated with MLN4924 for 6 h. Cells were then either lysed or MLN4924 was chased out with or without MG132 (10 μM) for 4 h before lysis. F TUBES pulldown of ubiquitylated NIX. FBXL4 KO RPE1‐Cas9i‐mt‐mkeima cells and matched control cells were treated as in E and lysates were subjected to a TUBES pulldown. G Quantitation of the amount of ubiquitylated NIX (Ub‐NIX) isolated in the TUBES‐pulldown normalized to total NIX protein levels in the input samples as shown in F. Data shown are from three independent colour‐coded experiments. Error bar shows standard deviation; unpaired t ‐test, **** P < 0.0001. H Schematic of proposed dual control of BNIP3 and NIX expression levels by VHL and FBXL4. Source data are available online for this figure.

Article Snippet: The PAC sgRNA (5′‐TGTCGAGCCCGACGCGCGTG‐3′) was cloned into the pSpCas9(BB)‐2A‐GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA‐1 (5′‐TTGGTCAGAGAGACCTACGA‐3′) and FBXL4 sgRNA‐2 (5′‐TGGACTACCTCTGCATTGAG‐3′) plasmids were cloned into the pLenti‐sgRNA (71409; Addgene) vector.

Techniques: Western Blot, Control, Standard Deviation, Lysis, Quantitation Assay, Isolation, Expressing

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Talin binding to the β7 cytoplasmic domain activates integrin α4β7. (A) Expression of talin and β7 in parental or talin KO β7-expressing Jurkat T cells. Top: Total expression by Western blot. Bottom: Surface expression by flow cytometry. The filled histograms represent untransfected Jurkat cells, whereas open histograms represent β7-expressing Jurkat cells or talin KO cells. (B) Binding of soluble MAdCAM-1 to β7 expressing Jurkat T cells or talin KO cells. PMA (100 nM) markedly increased binding to parental but not talin KO cells. Mn 2+ (0.5 mM) stimulated binding to both cell types. Stimulated cells were compared with resting (None) for each cell line using one-way ANOVA. (C) Adhesion of β7-expressing Jurkat T cells or Jurkat-talin KO cells to MAdCAM-1 substrate in the presence or absence of PMA (100 nM) under a wall shear stress of 2 dyn/cm 2 . Nontransfected Jurkat T cells (Jurkat) provided a negative control. Jurkat-β7-Talin KO or Jurkat were compared with the Jurkat-β7 for each condition using one-way ANOVA. (D) Structural model of the talin F3 domain in complex with integrin β7 tail (Arg 728 to Thr 766 ). Talin F3 domain is shown by a surface representation and colored by charge. A ribbon diagram of the docked β7 tail is highlighted in red. β7-Leu 758 and -Tyr 759 in the NPLY motif are shown as light blue–colored stick figures. (E) Soluble MAdCAM-1 binding to 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection. Mn 2+ (0.5 mM) was used as a positive control for integrin activation. Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (F) Adhesion of 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (G) Binding of soluble MAdCAM-1 to 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A). THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using two-way ANOVA. MFI, mean fluorescent intensity. (H) Adhesion of 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A) on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . 293T cells transfected with THD only and nontransfected 293T cells (MOCK) were used as negative controls. THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using one-way ANOVA. Error bars show means ± SD. n = 5. NS, P > 0.05; *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Binding Assay, Expressing, Western Blot, Flow Cytometry, Shear, Negative Control, Transfection, Mutagenesis, Cotransfection, Positive Control, Activation Assay, Plasmid Preparation, Control

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Blocking talin-induced change in β7 TMD topology abolished α4β7 activation. (A) Sequence alignment of partial TMDs of integrin β3 and β7 subunits. β3 Pro mutant site Ala 711 is highlighted in red. The sites in β7 that were mutated to Pro (Leu 721 and Leu 723 ) are highlighted in green and Gly 722 is highlighted in pink and are projected onto a homology model of the α4β7 TMD (α4 in blue and β7 in red). (B) Adhesion of 293T cells transfected with β7 WT or mutations (L721P, G722P, or L723P) plus α4 on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . Nontransfected 293T cells (MOCK) were used as a negative control (Ctrl). Mutant integrins were compared with the WT using one-way ANOVA. (C) Binding of soluble MAdCAM-1 to 293T cells transfected with WT α4β7 or α4 in combination with mutants (L721P, G722P, and L723P) in the presence or absence of THD. Nontransfected 293T cells (MOCK) were used as a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. Error bars show means ± SD. n = 5 (A and B) or 4 (C). *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001. MFI, mean fluorescence intensity. (D) Coimmunoprecipitation of THD with α4β7 WT or mutants. Lysates of 293T cells were transfected as in C, in combination with THD-GFP, and α4β7 was isolated by immunoprecipitation (IP). Precipitated proteins were analyzed by Western blotting with the indicated antibodies and confirmed similar THD association with the mutant and WT integrins. Data are representative of at least three independent experiments. Note that a shorter exposure time was used for the THD input. Molecular masses are given in kilodaltons. (E) A model of how a Pro mutation can prevent transmission of altered topology of the β7 TMD by talin. The complex formed between the β7 cytoplasmic tail/TMD (red) and cytoplasmic talin F3 domain (surface representation; colored by charge) alters the topology of the inner portion of the transmembrane helix, which is transmitted to the outer moiety, where it can disrupt the outer membrane clasp , resulting in destabilization of the α-β TMD complex and integrin activation. β7(L721P) breaks the TMD helix into two helices connected by a flexible kink; the flexible kink prevents transmission of the talin-induced change in intracellular TMD topology to stabilize the α-β TMD interaction and block talin-induced activation of integrin α4β7.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Blocking Assay, Activation Assay, Sequencing, Mutagenesis, Transfection, Shear, Negative Control, Binding Assay, Fluorescence, Isolation, Immunoprecipitation, Western Blot, Transmission Assay, Membrane

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Inhibiting talin-induced change in β7 TMD topology impairs agonist-induced α4β7 activation. (A) Binding of soluble MAdCAM-1 to Jurkat T cells stably expressing WT or mutant β7(L721P or L723P) with or without CXCL12 or PMA stimulation. Mutant integrins were compared with the WT for each condition using one-way ANOVA. Error bars show means ± SD. n = 5. NS, P > 0.05; **, 0.001 < P < 0.01; ***, P < 0.001. MFI, mean fluorescence intensity. (B) β7 cell surface expression on Jurkat T cells stably expressing WT or mutant β7(L721P or L723P). Mock-transfected cells are depicted in the filled histograms. (C) α4β7 was immunoprecipitated (IP) from lysates of CXCL12-stimulated cells or unstimulated cells depicted in A, and bound proteins were analyzed by Western blotting with the indicated antibodies. Data are representative of at least three independent experiments. Molecular masses are given in kilodaltons.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Activation Assay, Binding Assay, Stable Transfection, Expressing, Mutagenesis, Fluorescence, Transfection, Immunoprecipitation, Western Blot

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Suppressing talin-induced change in β7 TMD topology perturbed mouse lymphocyte homing to the gut. (A) Cell surface expression of α4β7 in TK1-β7 KO cells stably expressing WT β7 or mutant β7(L721P). (B) Binding of soluble mouse MAdCAM-1 to the cells shown in A with or without CXCL12 stimulation. The TK1-β7 KO cell was used as a negative control. Stimulated cells were compared with resting (None) for each cell line using one-way ANOVA. MFI, mean fluorescence intensity. (C and D) In vivo competitive homing of TK1-β7 KO cells that stably express WT β7(β7 WT) or proline mutant β7(β7[L721P]) to different lymphoid tissues. TK1-β7 WT or TK1-β7(L721P) cells were labeled with eFluor 670. TK1 parental (TK1) cells were labeled with CFSE as an input control. Equal numbers (2 × 10 7 ) of eFluor 670–labeled cells and CFSE-labeled cells were mixed and then intravenously injected into C57BL/6J mice. Lymphoid organs were isolated 2 h after injection. The eFluor 670– or CFSE-labeled cells that homed into different lymphoid organs were enumerated by flow cytometry. The total numbers of homed cells to different lymphoid organs are shown in C. MLN (per mouse), PP (per mouse), PLN (per lymph node), and SP (per mouse). The ratio of TK1 parental cells to TK1-KO cells reconstituted with β7 WT or β7(L721P) cells recovered from different lymphoid organs is shown in D. Error bars show means ± SD. n = 5 (A and B) or 24 (C and D). NS, P > 0.05; **, 0.001 < P < 0.01; ***, P < 0.001.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Expressing, Stable Transfection, Mutagenesis, Binding Assay, Negative Control, Fluorescence, In Vivo, Labeling, Control, Injection, Isolation, Flow Cytometry

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Disruption of GALT development in Itgb7 L720P/L720P mice. (A) Schematic of the Cas9/sgRNA-targeting sites in Itgb7 . The sgRNA-targeting sequences are underlined in blue, and the protospacer-adjacent motif (PAM) sequence is labeled in blue in the WT sequence. The MaeI restriction site removed from the WT and ApaI site introduced in the mutant are labeled as are the Leu codon changed to Pro. (B) Sequencing analysis of WT and β7(L720P) knock-in mice. DNA sequencing confirmed a leucine to proline substitution at position 720 of the mouse β7 integrin gene (position 721 in human β7 integrin gene). The mutation is labeled in red. The silent mutations are labeled in green and with green asterisks. (C) The absolute number of CD3 + T cells and B220 + B cells isolated from Itgb7 WT/WT mice and Itgb7 WT/L720P , or Itgb7 L720P/L720P littermates are shown. Error bars show means ± SD. n = 8. NS, P > 0.05; ***, P < 0.001.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Disruption, Sequencing, Labeling, Mutagenesis, Knock-In, DNA Sequencing, Isolation

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Itgb7 L720P/L720P adult mice have reduced gut-tropic β7 high effector/activated T cells. (A) Equivalent cell surface expression of integrin αL, α4, β1, β2, and β7 and intracellular expression of kindlin 3 and talin in neonatal Itgb7 WT/WT mice and Itgb7 L720P/L720P littermates are shown. (B) Cell surface expression of β7 is reduced in 8-wk-old Itgb7 L720P/L720P compared with Itgb7 WT/WT littermates. (C) The ratio of cell surface expression of integrin β7 on effector/activated T cells (CD62L low CD44 high ) compared with naive T cells (CD62L high CD44 low ) in 8-wk-old Itgb7 WT/WT mice and Itgb7 L720P/L720P littermates. Mean fluorescence intensities are displayed on the representative histograms. Error bars show means ± SD. **, 0.001 < P < 0.01. Teff, effector T cells.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Expressing, Fluorescence

Journal: Journal of Molecular Cell Biology

Article Title: RIG-I immunotherapy overcomes radioresistance in p53-positive malignant melanoma

doi: 10.1093/jmcb/mjad001

Figure Lengend Snippet: Whole-genome transcriptional analysis of B16 cells treated with combined radiotherapy–RIG-I immunotherapy reveals activation of p53 signalling. ( A and C ) Gene-expression analysis (Affymetrix GeneChip) of total RNA from B16 cells at 6 h after stimulation with 50 ng/ml 3pRNA or AC 20 control RNA, alone or in combination with 2 Gy irradiation. Volcano plots of single and combination treatments in comparison to the control ( A ) and combination treatment vs. 3pRNA treatment ( C ). Coloured data points show upregulation (red) or downregulation (blue) of at least 2-fold change. False discovery rate-corrected P -value < 0.05. ( B and D ) Pathway analysis (Wikipath) of genes found in A and C , respectively, using the TAC software of Thermo Fisher ordered by significance.

Article Snippet: The CRISPR target site for murine p53 (single guide (sg) RNA: 5′-CTGAGCCAGGAGACATTTTC-3′) was cloned into a px330 plasmid (px330-U6-Chimeric_BB-CBh-hSpCas9, Addgene plasmid #42230) and the site for human p53 (sgRNA: 5′-GCATCTTATCCGAGTGGA-3′) was cloned into a px459 plasmid (pSpCas9(BB)-2A-Puro (px459) V2.0, Addgene plasmid #62988), both kindly provided by Daniel Hinze from the lab of Michael Hölzel.

Techniques: Activation Assay, Gene Expression, Control, Irradiation, Comparison, Software

Journal: Journal of Molecular Cell Biology

Article Title: RIG-I immunotherapy overcomes radioresistance in p53-positive malignant melanoma

doi: 10.1093/jmcb/mjad001

Figure Lengend Snippet: Combined radiotherapy–RIG-I immunotherapy induces p53 pathway activation and prolongs cell-cycle arrest. ( A and B ) Western blot analysis of phospho-p53 (Ser15), total p53, p21, and PUMA expression after irradiation (2 Gy), transfection of 50 ng/ml 3pRNA, or both in B16 cells at the indicated time points. Actin served as a protein-loading control. ( C ) Flow-cytometric cell-cycle analysis of B16 cells stained with propidium iodide at the indicated time points. Mean ± SEM of n = 2. ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; two-way ANOVA.

Article Snippet: The CRISPR target site for murine p53 (single guide (sg) RNA: 5′-CTGAGCCAGGAGACATTTTC-3′) was cloned into a px330 plasmid (px330-U6-Chimeric_BB-CBh-hSpCas9, Addgene plasmid #42230) and the site for human p53 (sgRNA: 5′-GCATCTTATCCGAGTGGA-3′) was cloned into a px459 plasmid (pSpCas9(BB)-2A-Puro (px459) V2.0, Addgene plasmid #62988), both kindly provided by Daniel Hinze from the lab of Michael Hölzel.

Techniques: Activation Assay, Western Blot, Expressing, Irradiation, Transfection, Control, Cell Cycle Assay, Staining

Journal: Journal of Molecular Cell Biology

Article Title: RIG-I immunotherapy overcomes radioresistance in p53-positive malignant melanoma

doi: 10.1093/jmcb/mjad001

Figure Lengend Snippet: Knocking out p53 reduces the response of melanoma cells to combination treatment. ( A – E ) Wildtype or p53 – / – B16 or A375 cells were transfected with 50 ng/ml 3pRNA or AC 20 control RNA, combined with or without 2 Gy irradiation. ( A and B ) Induction of cell death was quantitated by Annexin V/7AAD staining and flow cytometry in B16 ( A ) and A375 ( B ) cells. ( C ) Flow-cytometric cell-cycle analysis with Hoechst 33342 at the indicated time points in B16 cells. ( D and E ) Surface calreticulin expression of B16 ( D ) and A375 ( E ) cells was monitored at 48 h after treatment by flow cytometry. ( F ) Wildtype or p53 – / – B16 cells were transfected with 200 ng/ml 3pRNA and irradiated (2 Gy) as indicated. After 48 h, cells were stained by eFluor780 dye and cocultured with BMDCs overnight. Activated DCs were analyzed by flow cytometry on the next day. All data are shown as mean ± SEM of n = 10 ( A ), n = 5 ( D ), or n = 3 ( B, C, E , and F ). * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; two-way ANOVA. geom. MFI, geometric mean fluorescence intensity; ns, not significant; w/o, untreated; non-irr., non-irradiated.

Article Snippet: The CRISPR target site for murine p53 (single guide (sg) RNA: 5′-CTGAGCCAGGAGACATTTTC-3′) was cloned into a px330 plasmid (px330-U6-Chimeric_BB-CBh-hSpCas9, Addgene plasmid #42230) and the site for human p53 (sgRNA: 5′-GCATCTTATCCGAGTGGA-3′) was cloned into a px459 plasmid (pSpCas9(BB)-2A-Puro (px459) V2.0, Addgene plasmid #62988), both kindly provided by Daniel Hinze from the lab of Michael Hölzel.

Techniques: Transfection, Control, Irradiation, Staining, Flow Cytometry, Cell Cycle Assay, Expressing, Fluorescence

Journal: Journal of Molecular Cell Biology

Article Title: RIG-I immunotherapy overcomes radioresistance in p53-positive malignant melanoma

doi: 10.1093/jmcb/mjad001

Figure Lengend Snippet: Synergistic antitumour activity of irradiation and RIG-I activation in vivo depends on functional p53 in melanoma. ( A ) Wildtype or p53 – / – B16 cells were subcutaneously transplanted into C57/BL6 mice. The mice were then locally irradiated (2 Gy), injected with 20 µg 3pRNA, or treated by both. After 16 h, the mice were sacrificed. Tumour-draining lymph nodes were analyzed by flow cytometry for CD69 surface expression of activated CD8 + T cells, CD4 + T cells, and NK1.1 + NK cells. Mean ± SEM of n = 3 with 3–5 mice per group and experiment. ( B ) Mice were treated as indicated over 7 days and the tumour size was measured daily. Mean ± SEM of n = 3 with 3–5 mice per group and experiment. ns, not significant; * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001; two-way ANOVA.

Article Snippet: The CRISPR target site for murine p53 (single guide (sg) RNA: 5′-CTGAGCCAGGAGACATTTTC-3′) was cloned into a px330 plasmid (px330-U6-Chimeric_BB-CBh-hSpCas9, Addgene plasmid #42230) and the site for human p53 (sgRNA: 5′-GCATCTTATCCGAGTGGA-3′) was cloned into a px459 plasmid (pSpCas9(BB)-2A-Puro (px459) V2.0, Addgene plasmid #62988), both kindly provided by Daniel Hinze from the lab of Michael Hölzel.

Techniques: Activity Assay, Irradiation, Activation Assay, In Vivo, Functional Assay, Injection, Flow Cytometry, Expressing

Journal: Advanced Science

Article Title: T‐2 Toxin‐Mediated β‐Arrestin‐1 O‐GlcNAcylation Exacerbates Glomerular Podocyte Injury via Regulating Histone Acetylation

doi: 10.1002/advs.202307648

Figure Lengend Snippet: T‐2 toxin infection increases β‐arrestin‐1 O‐GlcNAcylation and enhances β‐arrestin‐1 stability in glomerular podocytes. A) O‐GlcNAc modified proteins were analyzed by Co‐IP combined with LC‐MS, and some target proteins have higher scores, as shown in figure A. B) Endogenous interplays of β‐arrestin‐1 with OGT and O‐GlcNAc. T‐2 toxin‐exposed podocytes treated with or without MG‐132 (2.5 µM) were subjected to CoIP using β‐arrestin‐1 antibody, followed by Western blot analysis. C,D) qPCR quantification analysis of β‐arrestin‐1 along with β‐arrestin‐2 mRNA levels in mouse glomeruli C) and podocytes D) ( n = 6). E,F) Western blot analysis of β‐arrestin‐1 and β‐arrestin‐2 protein levels in mouse glomeruli E) and podocytes F) ( n = 6). G–I) Immunofluorescence staining analysis of β‐arrestin‐1 and β‐arrestin‐2 in mouse glomeruli G) and in podocytes H,I) ( n = 3). *** p < 0.001; data are expressed as mean ± SEM; unpaired t‐test was used in 2C, 2E, and one‐way ANOVA followed by Dunnett's post hoc test was used in 2D and 2F.

Article Snippet: Cells were infected with lentiviruses coding β‐arrestin‐1 ‐sgRNA (neomycin resistant) and then selected with G418 (MCE HY‐17561).

Techniques: Infection, Modification, Co-Immunoprecipitation Assay, Liquid Chromatography with Mass Spectroscopy, Western Blot, Immunofluorescence, Staining

Journal: Advanced Science

Article Title: T‐2 Toxin‐Mediated β‐Arrestin‐1 O‐GlcNAcylation Exacerbates Glomerular Podocyte Injury via Regulating Histone Acetylation

doi: 10.1002/advs.202307648

Figure Lengend Snippet: β‐arrestin‐1 overexpression exacerbates podocyte injury upon T‐2 toxin exposure. A) The urine albumin‐to‐creatinine ratio in T‐2 toxin‐fed mice treated with rAAV‐CAG‐GFP‐Cas9‐sg β‐arrestin‐1 or rAAV‐CAG‐GFP ( n = 6). B) Representative images of PAS as well as MASSON‐stained renal cortex sections were exhibited (scale bar, 50 µm) ( n = 3). C) GBM thickness. D) Number of foot processes of mice under transmission electron microscope (TEM) (Scale bar, 2 µm in upper panel; 500 nm in lower panel, n = 5). E) Foot process width. F) The infection efficiency of rAAV‐CAG‐GFP‐Cas9‐sg β‐arrestin‐1 or rAAV‐CAG‐GFP in mice glomeruli was validated by immunofluorescence staining ( n = 3, scale bar, 20 µm). G) Quantitation of Nephrin as well as Podocin protein levels in podocytes after transfection of control siRNA or β‐arrestin‐1 siRNA and their corresponding controls by western blot ( n = 6). H) Immunofluorescence staining was used to analyze Nephrin and Podocin in mouse glomeruli infected with CAG‐GFP‐Cas9‐sg β‐arrestin‐1 or CAG‐GFP ( n = 3, scale bar, 25 µm). *** p < 0.001, +++ p < 0.001, data are expressed as mean ± SEM; one‐way ANOVA followed by Tukey's post hoc test was used.

Article Snippet: Cells were infected with lentiviruses coding β‐arrestin‐1 ‐sgRNA (neomycin resistant) and then selected with G418 (MCE HY‐17561).

Techniques: Over Expression, Staining, Transmission Assay, Microscopy, Infection, Immunofluorescence, Quantitation Assay, Transfection, Control, Western Blot

Journal: Advanced Science

Article Title: T‐2 Toxin‐Mediated β‐Arrestin‐1 O‐GlcNAcylation Exacerbates Glomerular Podocyte Injury via Regulating Histone Acetylation

doi: 10.1002/advs.202307648

Figure Lengend Snippet: β‐arrestin‐1 mediates histone H4 hyperacetylation via recruiting p300 in T‐2 toxin‐induced podocyte injury. (A‐B) Western blot analyzed H3ac and H4ac protein levels in glomeruli of T‐2 toxin‐ stimulated mice A) and in T‐2 toxin‐treated podocytes B) ( n = 6). C) Western blot analysis of H3ac and H4ac protein levels in glomeruli of mice transfected with CAG‐GFP‐Cas9‐sg β‐arrestin‐1 or CAG‐GFP ( n = 6). D) Western blot analysis of H4ac protein levels in podocytes transfected with control siRNA or β‐arrestin‐1 siRNA ( n = 6). E) Western blot analyzed p300 protein levels in glomeruli ( n = 6). F) Western blot analysis of p300 protein levels in glomeruli of mice transfected with CAG‐GFP‐Cas9‐sg β‐arrestin‐1 or CAG‐GFP ( n = 6). G) Western blot analysis of p300 protein levels in podocytes transfected with β‐arrestin‐1 siRNA ( n = 6). H) Podocytes were treated with or without T‐2 toxin in the presence or absence of MG‐132. The interaction of β‐arrestin‐1 and p300 was determined by Co‐IP combined with Western blot analysis. I) Co‐IP combined with Western blot was used to detect β‐arrestin‐1 and p300 protein interaction in glomeruli of mice transfected with CAG‐GFP‐Cas9‐sg β‐arrestin‐1 or CAG‐GFP. J,K) Western blot analysis of J) H4ac, K) Nephrin and Podocin protein levels in podocytes after transfection with p300 siRNA ( n = 6). * p < 0.05, +++ p < 0.001, data are expressed as mean ± SEM. Unpaired t‐test was used in 4A, 4B, and 4E, and one‐way ANOVA followed by Tukey's post hoc test was used in 4C, 4D, 4F, 4G, 4J, and 4K.

Article Snippet: Cells were infected with lentiviruses coding β‐arrestin‐1 ‐sgRNA (neomycin resistant) and then selected with G418 (MCE HY‐17561).

Techniques: Western Blot, Transfection, Control, Co-Immunoprecipitation Assay

Journal: Advanced Science

Article Title: T‐2 Toxin‐Mediated β‐Arrestin‐1 O‐GlcNAcylation Exacerbates Glomerular Podocyte Injury via Regulating Histone Acetylation

doi: 10.1002/advs.202307648

Figure Lengend Snippet: β‐arrestin‐1 inhibits autophagy to exacerbate podocyte damage through acetylation of H4K16 to activate mTOR pathway. A) H4 acetylation at lysine 16 was detected by LC‐MS/MS in T‐2 toxin‐exposed podocytes. (B‐C) Endogenous interactions of H4K16 with β‐arrestin‐1 and p300 in podocytes were assessed using Co‐IP assay with H4K16 B) or β‐arrestin‐1 C) antibodies. D) Chromatin immunoprecipitation sequencing (ChIP‐Seq) analysis of H4K16 targeted binding gene fragments in T‐2 toxin‐exposed podocytes. 1) Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of ChIP‐Seq results showed the activation of mTOR signaling pathway in T‐2 toxin‐exposed podocytes. 2) The bubble diagram showed that H4K16ac is significantly enriched in the mTOR promoter region. 3) The Venn map showed that mTOR promoter is the only overlapping candidate gene by ChIP‐Seq and RNA‐Seq results. 4) Normalized ChIP‐seq tracks showed the enrichment of H4K16ac on mTOR promoter. Regions with differences in H4K16ac enrichment were highlighted in the lavender box. (E‐H) Western blot analysis of p‐mTOR (s2448) (E,F), p‐mTOR (s2481) (E,F), light chain 3 (LC3) (G,H), Beclin1 (G,H), and autophagy related 5 (ATG5) (G‐H) protein levels in mouse glomeruli (E and G) and podocytes (F and H) ( n = 6). I) Representative electronic micrographs showed the number of autophagosomes in glomerular podocytes ( n = 3). The arrows exhibit autophagosomes. Scale bar: 1 µm. J) Western blot analysis of p‐mTOR (s2448), LC3, Beclin1, and ATG5 in podocytes after transfection with β‐arrestin‐1 siRNA. K) LC3 staining in podocytes ( n = 3). Scale bar, 20 µm. L) Western blot analysis of p‐mTOR (s2448), LC3, Beclin1, and ATG5 in glomeruli of mice infected with rAAV‐CAG‐GFP‐Cas9‐sg β‐arrestin‐1 or rAAV‐CAG‐GFP ( n = 6). M) The number of autophagosomes in mice glomerular podocytes was shown by TEM ( n = 3). *** p < 0.001, +++ p < 0.001, data are expressed as mean ± SEM; unpaired t‐test was used in 5E, 5F, 5G, and 5H, and one‐way ANOVA followed by Tukey's post hoc test was used in 5J and 5L.

Article Snippet: Cells were infected with lentiviruses coding β‐arrestin‐1 ‐sgRNA (neomycin resistant) and then selected with G418 (MCE HY‐17561).

Techniques: Liquid Chromatography with Mass Spectroscopy, Co-Immunoprecipitation Assay, ChIP-sequencing, Binding Assay, Activation Assay, RNA Sequencing, Western Blot, Transfection, Staining, Infection

Journal: Advanced Science

Article Title: T‐2 Toxin‐Mediated β‐Arrestin‐1 O‐GlcNAcylation Exacerbates Glomerular Podocyte Injury via Regulating Histone Acetylation

doi: 10.1002/advs.202307648

Figure Lengend Snippet: Modification of β‐arrestin‐1 with O‐linked N‐acetylglucosamine stabilizes β‐arrestin‐1 by preventing its ubiquitin‐dependent proteolysis. A) Expression of β‐arrestin‐1 binding proteins in normal or T‐2 toxin‐exposed podocytes was shown in a heat map. B) Endogenous interplays of β‐arrestin‐1 with MIB1 and ubiquitin. T‐2 toxin‐exposed podocytes with or without MG‐132 were subject to Co‐IP using a β‐arrestin‐1 antibody, followed by Western blot analysis with MIB1 and ubiquitin antibodies. (C‐D) Co‐IP and Western blot analyzed β‐arrestin‐1 ubiquitination levels in podocytes cultured with or without T‐2 toxin transfected with control siRNA, MIB1 siRNA C) or OGT siRNA D). E) GlcNAc‐modified β‐arrestin‐1 at site threonine 98 was detected by LC‐MS/MS in T‐2 toxin‐exposed podocytes as compared with normal controls. F) Five candidate O‐GlcNAcylated residues of β‐arrestin‐1, identified by MS, were exhibited in the context of protein domains, secondary structure elements, along with interacting partners of β‐arrestin‐1. The figure below shows the predictive β‐arrestin‐1 domain for MIB1 binding. G) Co‐IP combined with Western blot analysis of the MIB1 binding domain in β‐arrestin‐1 in podocytes transfected with Flag‐tagged MIB1 overexpressed plasmid or different HA‐tagged β‐arrestin‐1 truncation plasmids. H) Molecular docking using PyMol showed that the O‐GlcNAcylation of β‐arrestin‐1 at sites of threonine 98 leads to the dissociation of MIB1 from β‐arrestin‐1. I) Myc‐tagged β‐arrestin‐1 constructs and Flag‐tagged MIB1 were transfected into Crispr/Cas9 β‐arrestin‐1 ‐KO podocytes, and then incubated with T‐2 toxin and MG‐132 in the presence or absence of OSMI‐1, and anti‐β‐arrestin‐1 antibody was used for IP. Precipitates were analyzed by Western blot analysis with indicated antibodies.

Article Snippet: Cells were infected with lentiviruses coding β‐arrestin‐1 ‐sgRNA (neomycin resistant) and then selected with G418 (MCE HY‐17561).

Techniques: Modification, Ubiquitin Proteomics, Expressing, Binding Assay, Co-Immunoprecipitation Assay, Western Blot, Cell Culture, Transfection, Control, Liquid Chromatography with Mass Spectroscopy, Plasmid Preparation, Construct, CRISPR, Incubation

Journal: Advanced Science

Article Title: T‐2 Toxin‐Mediated β‐Arrestin‐1 O‐GlcNAcylation Exacerbates Glomerular Podocyte Injury via Regulating Histone Acetylation

doi: 10.1002/advs.202307648

Figure Lengend Snippet: OGT deletion reduces β‐arrestin‐1 expression and alleviates mTOR pathway‐mediated glomerular podocyte injury in T‐2 toxin‐fed mice. A) Representative images of PAS and MASSON‐stained renal cortex sections (scale bar, 40 µm, n = 3). B) GBM thickness. C) TEM showed podocyte morphology (Scale bar, 500 nm, n = 5) and number of autophagosomes (Scale bar, 200 nm, n = 5). D) Foot process width. (E‐G) Western blot analyzed Nephrin E), Podocin E), β‐arrestin‐1 F), p300 F), H4K16ac F), p‐mTOR (s2448) G), LC3 G), Beclin1 G) and ATG5 G) protein levels in glomeruli ( n = 6). H) The interplays of β‐arrestin‐1 with MIB1, O‐GlcNAc, and β‐arrestin‐1 ubiquitination and O‐GlcNAcylation in isolated glomeruli were analyzed by Co‐IP. I) The interaction of β‐arrestin‐1 with p300 and H4K16ac in isolated glomeruli was analyzed by Co‐IP. *** p < 0.001, +++ p < 0.001, data are expressed as mean ± SEM; one‐way ANOVA followed by Tukey's post hoc test was used.

Article Snippet: Cells were infected with lentiviruses coding β‐arrestin‐1 ‐sgRNA (neomycin resistant) and then selected with G418 (MCE HY‐17561).

Techniques: Expressing, Staining, Western Blot, Ubiquitin Proteomics, Isolation, Co-Immunoprecipitation Assay

Journal: Environmental Health Perspectives

Article Title: Amniogenesis in Human Amniotic Sac Embryoids after Exposures to Organophosphate Flame Retardants

doi: 10.1289/ehp11958

Figure Lengend Snippet: Figure 1. Screening of OPFRs that inhibited OCT4 expression. (A) Screening and toxicity evaluation of OPFRs; (B) Relative fluorescence intensity (means ± SDs) of OCT4-luciferase (tdTomato) H1 cell line exposed to OPFRs (10,000 nM); (C) Relative fluorescence intensity (means ± SDs) of Sytox Green (green) in hESC exposed to OPFRs (10 lM); (D) Structure of identified chemicals, TXP, 2IPPDPP, 4tBPDPP, EHDPP, IDDPP, TAP, BEHP, TDBPP. Data in (C) and (D) are expressed relative to the levels in DMSO-treated hESC, which were set to 1. n = 3. Data were analyzed using an unpaired two-tailed Student’s t-test. Indicated values are significantly different from the control value. Numeric data in (C) and (D) were listed in Table S5. Note: 2IPPDPP, 2-isopropyl- phenyl diphenyl phosphate; 4tBPDPP, 4-tert-butylphenyl diphenyl phosphate; BEHP, bis(2-ethylhexyl) phosphate; DMSO, dimethyl sulfoxide; EHDPP, 2-eth- ylhexyl-diphenyl phosphate; IDDPP, isodecyl diphenyl phosphate; OCT4, octamer-binding transcription factor 4; OPFRs, organophosphate flame retardants; SD, standard deviation; TAP, triamyl phosphate; TDBPP, tris(2,3-dibromopropyl) phosphate; TXP, tris(3,5-xylenyl) phosphate. *p < 0:05. **p < 0:01. Created with BioRender.com.

Article Snippet: The OCT-tdTomato luciferase H1 cell line was established by the School of Basic Medical Sciences in Peking University.21 Briefly, OCT4 sgRNA was introduced into the modified Px330 (42230; Addgene), and the sequence of constructed plasmid is provided in Supplemental Material, “Sequence of OCT4-sgRNA Px330 Plasmid.”Next, OCT4-tdTomato plasmidwas nucleofected together with OCT4-sgRNA Px330 plasmid in H1 cell line by 4DNucleofector System (Lonza) using a transfection kit (VAPH5012; Lonza); the sequence of OCT4-tdTomato plasmid is provided in Supplemental Material, “Sequence of OCT4-tdTomato Plasmid.” The OCT-tdTomato-luciferase H1 cell medium included DMEM/F12 (C11330500BT; Coolaber) supplemented with 20% knockout serum replacement (KSR) (A3181502; Gibco), 1% GlutaMAX (35050-061; Thermo Fisher Scientific), 1% nonessential amino acids (11140-050; Thermo Fisher Scientific), 0:1mM of b-mercaptoethanol (21985-023; Thermo Fisher Scientific), and 4Octng=ml of fibroblast growth factorbasic (bFGF) (P5453; Beyotime).

Techniques: Expressing, Luciferase, Two Tailed Test, Control, Binding Assay, Standard Deviation

Journal: Environmental Health Perspectives

Article Title: Amniogenesis in Human Amniotic Sac Embryoids after Exposures to Organophosphate Flame Retardants

doi: 10.1289/ehp11958

Figure Lengend Snippet: Figure 3. Evaluation of functional markers in amniotic sac embryoids exposed to EHDPP. (A) OCT4 (yellow) and DAPI (blue) in the control and EHDPP ex- posure groups at 72 h; (B) Relative intensity of OCT4 (means ± SDs) in the control and EHDPP exposure groups at 72 h; (C) TFAP2A (red), CDX2 (green), and DAPI (blue) in the control and EHDPP exposure groups at 96 h; (D) Relative intensity of TFAP2A (means ± SDs) in the control and EHDPP exposure groups at 96 h; (E) Relative intensity of CDX2 (means ± SDs) in the control and EHDPP exposure groups at 96 h. Scale bars, 20 lm. Data in (B), (D), and (E), were expressed relative to the levels in DMSO-treated embryoids, which were set to 1. n = 3. Data were analyzed using Student’s t-test. Indicated values were significantly different from the control value. Numeric data in (B), (D) and (E) were listed in Table S6. Note: CDX2, caudal-type homeobox 2; DAPI, 40,6-diamidino-2-phenylindole; DMSO, dimethyl sulfoxide; EHDPP, 2-ethylhexyl-diphenyl phosphate; OCT4, octamer-binding transcription factor 4; SD, standard deviation; TFAP2A, transcription factor AP-2a. *p < 0:05. **p < 0:01.

Article Snippet: The OCT-tdTomato luciferase H1 cell line was established by the School of Basic Medical Sciences in Peking University.21 Briefly, OCT4 sgRNA was introduced into the modified Px330 (42230; Addgene), and the sequence of constructed plasmid is provided in Supplemental Material, “Sequence of OCT4-sgRNA Px330 Plasmid.”Next, OCT4-tdTomato plasmidwas nucleofected together with OCT4-sgRNA Px330 plasmid in H1 cell line by 4DNucleofector System (Lonza) using a transfection kit (VAPH5012; Lonza); the sequence of OCT4-tdTomato plasmid is provided in Supplemental Material, “Sequence of OCT4-tdTomato Plasmid.” The OCT-tdTomato-luciferase H1 cell medium included DMEM/F12 (C11330500BT; Coolaber) supplemented with 20% knockout serum replacement (KSR) (A3181502; Gibco), 1% GlutaMAX (35050-061; Thermo Fisher Scientific), 1% nonessential amino acids (11140-050; Thermo Fisher Scientific), 0:1mM of b-mercaptoethanol (21985-023; Thermo Fisher Scientific), and 4Octng=ml of fibroblast growth factorbasic (bFGF) (P5453; Beyotime).

Techniques: Functional Assay, Control, Binding Assay, Standard Deviation

Journal: Environmental Health Perspectives

Article Title: Amniogenesis in Human Amniotic Sac Embryoids after Exposures to Organophosphate Flame Retardants

doi: 10.1289/ehp11958

Figure Lengend Snippet: Figure 4. Evaluation of functional markers in amniotic sac embryoids exposed to IDDPP. (A) OCT4 (yellow) and DAPI (blue) in the control and IDDPP expo- sure groups at 72 h; (B) Relative intensity of OCT4 (means ± SDs) in the control and IDDPP exposure groups at 72 h; (C) TFAP2A (red), CDX2 (green), and DAPI (blue) in the control and IDDPP exposure groups at 96 h; (D) intensity of TFAP2A (means ± SDs) in the control and IDDPP exposure groups at 96 h; (E) intensity of CDX2 (means ± SDs) in control and IDDPP exposure groups at 96 h. Scale bars, 20 lm. Data in (B), (D), and (E), were expressed relative to the levels in DMSO-treated embryoids, which were set to 1. n = 3. Data were analyzed using Student’s t-test. Indicated values were significantly different from the control value. Numeric data in (B), (D) and (E) were listed in Table S6. Note: CDX2, caudal-type homeobox 2; DAPI, 40,6-diamidino-2-phenylindole; DMSO, dimethyl sulfoxide; IDDPP, isodecyl diphenyl phosphate; OCT4, octamer-binding transcription factor 4; SD, standard deviation; TFAP2A, transcrip- tion factor AP-2a. *p < 0:05. **p < 0:01.

Article Snippet: The OCT-tdTomato luciferase H1 cell line was established by the School of Basic Medical Sciences in Peking University.21 Briefly, OCT4 sgRNA was introduced into the modified Px330 (42230; Addgene), and the sequence of constructed plasmid is provided in Supplemental Material, “Sequence of OCT4-sgRNA Px330 Plasmid.”Next, OCT4-tdTomato plasmidwas nucleofected together with OCT4-sgRNA Px330 plasmid in H1 cell line by 4DNucleofector System (Lonza) using a transfection kit (VAPH5012; Lonza); the sequence of OCT4-tdTomato plasmid is provided in Supplemental Material, “Sequence of OCT4-tdTomato Plasmid.” The OCT-tdTomato-luciferase H1 cell medium included DMEM/F12 (C11330500BT; Coolaber) supplemented with 20% knockout serum replacement (KSR) (A3181502; Gibco), 1% GlutaMAX (35050-061; Thermo Fisher Scientific), 1% nonessential amino acids (11140-050; Thermo Fisher Scientific), 0:1mM of b-mercaptoethanol (21985-023; Thermo Fisher Scientific), and 4Octng=ml of fibroblast growth factorbasic (bFGF) (P5453; Beyotime).

Techniques: Functional Assay, Control, Binding Assay, Standard Deviation